In (36/Ecadherin) (BD Biosciences); IL-13Ra (B-D13), c-Kit (104D2) (Santa Cruz > 자유게시판

In (36/Ecadherin) (BD Biosciences); IL-13Ra (B-D13), c-Kit (104D2) (Santa Rosiglitazone Cruz Biotechnology, Santa Cruz, CA); CD44v6 (VFF-7) (Abcam, Cambridge, MA); CD133 (TMP4) (eBioscience); FABP5 (311215) (R D Systems, Minneapolis, MN); and anti-human Epidermal Growth Factor Receptor (CTL-R2) (Cancer Therapeutics Laboratories, Inc., Los Angeles, CA). Staining with isotype controls antibodies (eBioscience) was performed in parallel, and all samples were done in duplicate. Samples were run on a FACS Calibur flow cytometer (BD) and data acquisition and analysis were performed using Cell Quest Pro software (BD) at the USC Flow Cytometry core facility.Table 1 Cytokine and Oncogene Primers for qRT-PCRTarget p53 Rb c-myc c-Kit VEGF-A VEGF-C COX2 TGFb-1 TGFb-2 IL-1b IL-4 IL-6 IL-8 IL-10 GAPDH Forward Primer 5' - GCTCGACGCTAGGATCTGAC - 5' 5' - GTTGGTCCTTCTCGGTCCTT - 3' 5' - CTCCTCCTCGTCGCAGTAGA - 3' 5' - GCCCACGCGGACTATTAAGT - 3' 5' - CACACAGGATGGCTTGAAGA - 3' 5' - CTCCAGATCTTTGCTTGCAT - 3'Genomic DNA was isolated from USC-HN1, HeLa, HUT102, Raji, FaDu, and SW579 cells using TRIreagent (Sigma) per manufacturer's instructions. For PCR, 50-100 ng of DNA was amplified with specified primers (300 nM final concentration) using REDTaq ReadyMix PCR Master Mix (Sigma) in a 25 l PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/25751659 reaction and run on an iCycler (BioRad, Hercules, CA). HPV infectivity was screened using previously reported consensus primers MY09/MY11 (expected product 450 bp) and GP5+/GP6+ (expected product 150 bp) [15,16]. Consensus primers for the EBV gene EBNA2 (expected product 600 bp) was used to screen for the presence of EBV as previously reported [17].Cytokine and oncogene analysis by qRT-PCRTotal RNA was isolated from USC-HN1 and FaDu human pharyngeal carcinoma cell lines by RNeasy Mini Kit (Qiagen, Valencia, CA) per manufacturer's instructions. RNA was DNase treated using Turbo DNase (Applied Biosciences, Foster City, CA) per manufacturer's instructions. For qRT-PCR, 100-200 ng of DNase-treated RNA was amplified with Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosciences). Primer sequences for cytokines and oncogenes were from the NIH qRT-PCR database [[18], http://primerdepot.nci.nih.gov] and were synthesized by the USC Core Facility (Table 1). Specific markers analyzed included p53, Rb, c-myc, c-Kit, VEGF-A, VEGF-C, Cox2, TGFb1, TGFb2, IL-1b, IL-4, IL-6, IL-8, andReverse Primer 5' - CAGGTAGCTGCTGGGCTC - 3' 5' - CAAAGCAGAAGGCAACTTGA - 3' 5' - GCTGCTTAGACGCTGGATTT - 3' 5' - CTGGGATTTTCTCTGCGTTC - 3' 5' - AGGGCAGAATCATCACGAAG - 3' 5' - CTGTGGCGTGTTCTCTGCT - 3' 5' - AGATCATCTCTGCCTGAGTATCTT - 3' 5' - CCCTGGACACCAACTATTGC - 3' 5' - CGACGAAGAGTACTACGCCA - 3' 5' - GAGCTCGCCAGTGAAATGAT - 3' 5' - CAGCCTCACAGAGCAGAAGA - 3' 5' - AGTGAGGAACAAGCCAGAGC - 3' 5' - CAAGAGCCAGGAAGAAACCA - 3' 5' - GTGGAGCAGGTGAAGAATGC - 3' 5' - TTAAAAGCAGCCCTGGTGAC - 3'5' - TTCAAATGAGATTGTGGGAAAATTGCT - 3' 5' - GCAGAAGTTGGCATGGTAGC - 3' 5' - CTCCATTGCTGAGACGTCAA - 3' 5' - GGAGATTCGTAGCTGGATGC - 3' 5' - AGCGAGTGTCCTTCTCATGG - 3' 5' - CATTTGTGGTTGGGTCAGG - 3' 5' - AGCACTCCTTGGCAAAACTG - 3' 5' - GCCACCCTGATGTCTCAGTT - 3' 5' - CTCTGCTCCTCCTGTTCGAC - 3'Liebertz et al. Head Neck Oncology 2010, 2:5 http://www.headandneckoncology.org/content/2/1/Page 5 ofIL-10. For amplification, samples were run on a Stratagene Mx3000P cycler with MxP QPCR software (Strategene, La Jolla, CA). Gene-specific amplification was normalized to GAPDH and fold change in gene expression calculated relative to Universal Human Reference RNA (Stratagen.